• Users Online: 611
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2013  |  Volume : 38  |  Issue : 2  |  Page : 84-89

SHP-1 expression in chronic myeloid leukemia ( clinical significance and impact on response to imatinib treatment)


Department of Clinical Pathology and Internal Medicine, Faculty of Medicine, Ain Shams University, Cairo, Egypt

Date of Submission05-Jan-2013
Date of Acceptance14-Feb-2013
Date of Web Publication20-Jun-2014

Correspondence Address:
Nihal M Heiba
Department of Clinical Pathology and Internal Medicine, Faculty of Medicine, Ain Shams University, Cairo
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.7123/01.EJH.0000428064.36941.33

Rights and Permissions
  Abstract 

Background

SH2-containing tyrosine phosphatase (SPH-1) is a negative regulator of protein tyrosine kinases and is also a tumor suppressor that is physically and functionally linked to BCR-ABL, the hallmark for pathogenesis, diagnosis, and targeted therapy in chronic myeloid leukemia (CML).

Aim

This study aimed at investigating the levels of SHP-1 mRNA during chronic phase (CP), accelerated phase (AP), and blast phase (BP) CML and also assessing its impact on the response of CP-CML patients to imatinib mesylate (IM) therapy.

Patients and methods

The study was carried out on 77 newly diagnosed CML patients (56 CP, 13 AP, and eight BP). Ten age-matched and sex-matched volunteers free from any hematological or nonhematological malignancies served as the control group. Patients were diagnosed and classified into appropriate phases according to the WHO criteria by clinical and radiological examination, cytomorphological analysis, neutrophil alkaline phosphatase scoring, conventional cytogenetic analysis, FISH for t(9; 22) and real-time quantitative PCR analysis for BCR-ABL fusion transcripts. CP patients received IM therapy and were followed up for assessment of the response to treatment. SHP-1 mRNA levels were measured at diagnosis using real-time quantitative PCR.

Results

SHP-1 levels were highly significantly increased in CP-CML patients (5.8–538; median 48.1) compared with normal controls (2.6–8.3; 5.2) and patients presenting with AP (2.1–168; 13.8) or BP (1.9–173; 12.3) (P<0.01). The levels were not correlated with the patients’ clinical or laboratory data. Follow-up of CP-CML patients on IM therapy revealed that patients with lower baseline SHP-1 levels were less likely to achieve a major molecular response at 18 months compared with those with higher levels. SHP-1 was highly significantly elevated in optimal responders compared with suboptimal responders and those who failed treatment (12.1–538; 63.2 vs. 5.8–177; 15.1) (P<0.01); these levels not being correlated to the Sokal risk score.

Conclusion

SHP-1 mRNA expression is downregulated in patients with more progressive CML. Moreover, determining the SHP-1 levels at diagnosis can provide a biological predictor of the IM response in patients with CP-CML.

Keywords: chronic myeloid leukemia, imatinib, SHP-1


How to cite this article:
Heiba NM, Elshazly SA. SHP-1 expression in chronic myeloid leukemia ( clinical significance and impact on response to imatinib treatment). Egypt J Haematol 2013;38:84-9

How to cite this URL:
Heiba NM, Elshazly SA. SHP-1 expression in chronic myeloid leukemia ( clinical significance and impact on response to imatinib treatment). Egypt J Haematol [serial online] 2013 [cited 2020 Jan 20];38:84-9. Available from: http://www.ehj.eg.net/text.asp?2013/38/2/84/134794


  Introduction Top


The enhanced protein tyrosine kinase (PTK) activity of the BCR-ABL1 protein represents the cornerstone of the pathogenesis of chronic myeloid leukemia (CML) through the phosphorylation and activation of a broad range of downstream substrate-modulating signal transductions and transformations and regulation of cell survival with resultant abnormal cell proliferation and differentiation 1. Recognition of the PTK activity of the BCR-ABL proteins has provided the rationale for the targeted use of tyrosine kinase inhibitors (TKIs) to abort the signals controlling the leukemic phenotype 2. One of the TKIs, imatinib mesylate (IM), an orally bioavailable 2-phenyl-aminopyrimidine, which specifically targets BCR-ABL1-KIT and PDGFR kinases, has proven to be highly active and safe in CML patients and has rapidly become the standard front-line therapy for the disease 3,4. Despite the fact that the response to therapy in CML chronic phase (CP) patients is highly acceptable, primary or acquired resistance to IM may occur in 20–30% of patients 5. Moreover, responses obtained in patients with more advanced disease (AD) phases, that is accelerated phase (AP) and blast phase (BP), are typically low and short-lived 6. Knowledge of the exact mechanisms underlying this resistance is limited but can be subdivided into BCR-ABL-dependent or BCR-ABL-independent. Mutations within the kinase domain of BCR-ABL is the most recognized and common mechanism of resistance; however, this seems to be particularly frequent in patients with acquired resistance, whereas it is by far less common in those with front-line resistance, wherein the BCR-ABL-independent molecular mechanisms appear to be of higher significance 7. The need to identify these mechanisms is of growing interest to optimize the use of IM therapy.

SH2-containing tyrosine phosphatase-1 (SHP-1) is one of the protein tyrosine phosphatases (PTPs), which are enzymes that catalyze the dephosphorylation of the phosphotyrosine residues to keep the tyrosine phosphorylation level at a dynamic equilibrium in the biological systems, thus playing a key role in regulating cytokine/PTK-mediated signaling 8. It is a cytosolic, 68 kD, nonreceptor PTP that is encoded by a gene located on chromosome 12p13 and is expressed at low levels in nonhematopoietic cells but widely expressed by hematopoietic precursors, wherein it is a key regulator of intracellular phosphotyrosine levels 9. Extensive studies on the SHP-1 protein and mRNA revealed its diminished or abolished expression in most cancer cell lines and tissues examined 10. Furthermore, decreased expression of the SHP-1 protein was demonstrated in mantle cell and follicular lymphoma 11 and pediatric acute lymphoblastic leukemia 12.

As regards the BCR-ABL kinase, its specific PTPs antagonists have not been entirely identified. However, there is evidence of the physical association between SHP-1 and BCR-ABL, together with their functional interaction 13,14. In fact, the CML blast cell line K562 has been demonstrated to lack the SHP-1 protein and mRNA, with their differentiation being coupled with SHP-1 expression 14. Only a few reports on SHP-1 expression in CML patients exist, the majority of the available information being from animal and cell line studies 10.

Therefore, the present study aimed to investigate the levels of SHP-1 mRNA in the three phases of CML (CP, AP, and BP) and also to assess the impact of its baseline levels on the response of CP-CML patients to IM therapy.


  Patients and methods Top


The study was carried out on 77 newly diagnosed consecutive Philadelphia chromosome-positive (Ph+) CML patients attending the Hematology/Oncology Unit of Ain Shams University Hospitals from September 2008 to August 2012; 51 were men and 26 were women (M :F =1.9 : 1), with ages ranging from 27–70 years (median=47). Bone marrow (BM) aspiration samples from 10 age-matched and sex-matched individuals with no hematological malignancies (e.g. hypersplenism and immune thrombocytopenia) served as controls. The procedures applied were approved by the local Research Ethics Committee, and a written informed consent was obtained from all participants before enrollment.

Patients were subjected to a full history taking, clinical examination, and radiological investigations. The diagnosis was confirmed using peripheral blood (PB) and BM aspiration samples on the basis of (i) a complete blood count using an LH 750 Coulter (Beckman Coulter Inc., Fulleroun, California, USA); (ii) cytomorphology of the Leishmann-stained PB and BM smears; (iii) neutrophil alkaline phosphatase scoring (Sigma, St Louis, Missouri, USA); (iv) conventional cytogenetic analysis (CCA) using the G-banding technique according to the standard protocols 15; (v) molecular cytogenetic analysis using an interphase FISH using a dual color dual fusion probe for the detection of BCR-ABL1, according to the instructions of Primo et al. 16; (vi) real-time quantitative PCR (RT-qPCR) for determination of baseline levels of BCR-ABL1 fusion transcripts to control the gene ratio 17.

The phases of CML were defined according to the WHO criteria 18, and the patients were classified into 56 with CP and 21 with AD (13 AP and eight BP). The relative risk (RR) of prognosis and death in CP-CML patients was calculated using the Sokal formula 19: 17/56 (30%) had low Sokal risk score (<0.8), 24 (43%) intermediate risk score (0.8–1.2) and 15 (27%) high-risk score (>1.2). Data of the patients are summarized in [Table 1].
Table 1: Data of the CML patients

Click here to view


CP-CML patients received standard doses of IM (400 mg/day) as a first-line therapy. Patients with AP received IM at a dose of 600–800 mg/day; however, patients who were intolerant to high-dose IM therapy or proved to have resistant BCR-ABL kinase domain mutations (T315I) on direct sequencing 20 were shifted to second-line TKI therapy (Nilotinib or Dasatinib). Patients in BP were classified into those having myeloid or lymphoid BP; they received induction protocols for acute lymphoblastic or myeloid leukemia, respectively, under the cover of TKI therapy according to the mutation screened and were scheduled for allogenic hematopoietic stem cell transplantation once in remission 21.

The follow-up protocol of patients was in accordance with that proposed by the European LeikemiaNet (ELN) 22. The patients were monitored every 2 weeks by complete blood counts and clinical examination until a complete hematological response was achieved and confirmed on two subsequent occasions (platelet count<450×109 /l; TLC<10×109 /l; differential white cell count without immature granulocytes and <5% basophils; no palpable spleen); they were then examined every 3 months. The cytogenetic response (CyR) was assessed by a CCA of at least 20 marrow metaphases and/or FISH of PB for BCR-ABL1 in at least 200 interphase nuclei, every 6 months, until a complete CyR (CCyR) was achieved; they were then assessed every 12 months. A CCyR was defined as 0% Ph+, partial CyR (PCyR) 1–35% Ph+, minor CyR 36–65% Ph+, minimal CyR 66–95% Ph+, and no CyR of more than 95% Ph+. The molecular response was determined using RT-qPCR for the BCR-ABL1 fusion transcripts every 3 months until the achievement of a major molecular response (MMR), defined as a ratio of BCR-ABL to the reference gene of 0.1% or less on the International Scale; thereafter, the analysis was carried out every 6 months.

Molecular and cytogenetic responses to IM therapy in the 56 CP-CML patients were assessed at 18 months from initiation of treatment by CCA, FISH, and RT-qPCR of BCR-ABL1; they were classified into optimal responders (achieving MMR), suboptimal responders (less than MMR, i.e. CCyR), and those who failed treatment (less than CCyR) according to ELN recommendations 22.

Samples

The PB and BM aspiration samples were collected into EDTA and lithium heparin vacutainer tubes for morphological, cytochemical, cytogenetic, and molecular analysis.

Evaluation of SHP-1 gene expression by RT-qPCR

RT-qPCR amplification was performed using predeveloped Assay-on-Demand gene expression sets for the SHP-1 gene (Hs00169359-m1; Applied Biosystems, Carlsband, California, USA) and the TaqMan glyceraldhyde-3-phosphate dehydrogenase (GAPDH) gene in combination with the TaqMan Universal PCR Master Mix (Applied Biosystems). The primer sets used for SHP-1 were: (a) pIRES-SHP-1: Fw: GTGAATGTTATTATAGTATAGTGTTTGG; Rv: TTCACACATACAAACCCAAACAAT and (b) qRT-SHP-1: Fw: CGAGGTGTCCACGGTAGCTT; Rv: CCCCTCCATACAGGTCATAGAAAT; Probe: Fam-TGACCCATATTCGGATCCAGAACTCAGG-Tamra.

Total cellular RNA was extracted from the BM samples using a QIAmp RNA blood kit (Qiagen, Valencia, California, USA), according to the manufacturer’s protocol. cDNA was synthesized using the TaqMan gene expression assay kit (Applied Biosystems, Carlsband, California, USA) and stored at −20°C until use. PCR products were synthesized from cDNA samples using the TaqMan Universal Master Mix. Each PCR cycle contained all the necessary reagents and 50 ng of cDNA in a final volume of 20 μl. The reaction protocol involved heating for 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of amplification (15 s at 95°C and 1 min at 60°C). Analysis of data was carried out using the Startagene Mx3000P software (Staragene Inc., Carlsband, California, USA). SHP-1 mRNA expression levels in unknown samples were calculated by relative quantification using the 2-ΔΔCt method 23 as a ratio of SHP-1 to GADPH. A negative control without a template was included in each assay. The Ct values of the samples were compared with the RNA obtained from a healthy individual to be used as a calibrator 24.

Statistical analysis

Quantitative data were described in the form of median and range. Comparisons between the groups with nonparametric variables were carried out using the Mann–Whitney test. Qualitative data were expressed as number and percentage, and the differences among the groups were compared using Fisher’s exact test. Correlations between two variables were determined using the Spearman–Rank correlation coefficient. All the tests were two tailed. P-values of less than 0.05 and those less than 0.01 were considered statistically significant and highly significant, respectively. The calculations were performed using the GraphPad Prism software, version 4.0 (GraphPad Software Inc., La Jolla, California, USA).


  Results Top


Levels of SHP-1 mRNA expression

The RT-qPCR determination of SHP-1 mRNA revealed that the SHP-1 : GAPDH ratio was highly significantly higher in CP-CML BM cells (range 5.8–538; median 48.1) compared with normal controls (2.6–8.3; 5.2) (P<0.01). Patients presenting with AD, that is those in AP and BP, had slightly significantly higher SHP-1 mRNA expression (2.1–168; 13.8 and 1.9–173; 12.3, respectively) compared with controls (P<0.05); however, these values were highly significantly lower compared with those of CP-CML patients (P<0.01) [Figure 1].
Figure 1: Levels of SHP-1 expression in CML patients compared with controls. SHP-1 is highly significantly elevated in CP-CML patients compared with AP and BP patients and controls (P<0.01). The box and whisker plots show in the box the median and the 25th and 75th percentile; the whiskers show the 2.5th and 7.5th percentile. AP, accelerated phase; BP, blast phase; CML, chronic myeloid leukemia; CP, chronic phase; SHP-1, SH2-containing tyrosine phosphatase-1.

Click here to view


The levels of SHP-1 expression did not significantly correlate with any of the clinical and laboratory data of the patients in CP-CML or AD subgroups (P>0.05; [Table 2].
Table 2: Relation of SHP-1 mRNA levels to data of CML patients

Click here to view


Imatinib treatment outcome in CP-CML

The patients were stratified according to the response to IM after 18 months of treatment. A total of 30 of 56 (53%) were in MMR and therefore were classified as optimal responders, 10 (18%) achieved a CCyR but not an MMR and were categorized as suboptimal responders, and the remaining 16 (29%) failed to achieve a CCyR and were therefore identified as having failed treatment.

A Sokal RR score was highly significantly correlated with the response to treatment, as the rates of achievement of MMR at 18 months were 12 of 17 (70%), 15 of 24 (62%), and three of 15 (20%) in low-risk, intermediate risk, and high-risk score patients, respectively (P<0.01; [Table 3]. However, the differences in Sokal scoring between the suboptimal responders and the treatment failure group failed to reach statistical significance (P>0.05).
Table 3: Relation of SHP-1 and Sokal scores to imatinib response after 18 months of therapy in CP-CML patients

Click here to view


Levels of SHP-1 in relation to imatinib response in CP-CML patients

The SHP-1 mRNA expression levels in the suboptimal responders and those who failed treatment (5.8–177; 15.1) were highly significantly lower compared with those in patients who achieved an MMR at 18 months (optimal responders) (12.1–538; 63.2) (P<0.01; [Figure 2].
Figure 2: SHP-1 expression according to the imatinib response in CP-CML patients after 18 months of therapy. Baseline SHP-1 is highly significantly lower in the suboptimal responders and those who failed treatment (less than MMR) compared with optimal responders (MMR) (P<0.01). The box and whisker plots show in the box the median and the 25th and 75th percentile; the whiskers show the 2.5th and 7.5th percentile. CML, chronic myeloid leukemia; CP, chronic phase; MMR, major molecular response; SHP-1, SH2-containing tyrosine phosphatase-1.

Click here to view


To further confirm this, patients were subdivided according to SHP-1 expression, taking the median (48.1) as a cutoff value, into high SHP-1 expressors (>48.1) and low SHP-1 expressors (⩽48.1). A total of 30 of 56 (54%) were low expressors and 26 of 56 (46%) were high expressors. A total of 22 of 30 optimal responders (73.3%) had higher levels of SHP-1 mRNA, whereas of the 26 suboptimal responders and those who failed treatment, 22 (84.6%) had lower SHP-1 mRNA levels (P<0.01) [Table 3]. The SHP-1 levels did not significantly differ between the suboptimal responders and those who failed treatment (P>0.05).

Of note, SHP-1 levels at diagnosis and the Sokal RR score in CP-CML patients were not significantly correlated with each other (P>0.05; [Table 2].


  Discussion Top


CML is a myeloproliferative neoplasm that originates from an abnormal pluripotent hematopoietic stem cell characterized by the presence of t(9; 22)(q34; q11.2)/BCR-ABL1 fusion, resulting in the Ph chromosome. The chimeric BCR-ABL1 fusion protein has constitutive TK activity that plays an essential role in CML pathogenesis through the interaction with several molecules controlling cell survival and death 1. SHP-1 is one of the PTPs that play a key role in regulating cytokine/PTK-mediated signaling and is considered a putative tumor suppressive gene that was demonstrated to be physically and functionally associated with BCR-ABL1 13,14.

In the present study, SHP-1 mRNA levels exhibited a marked variation in patients in different phases of CML, being highly significantly elevated in CP-CML patients compared with controls and highly significantly decreased in AD-CML (AP and BP) patients compared with CP-CML patients, though slightly higher compared with controls. These data are concordant with those reported by Amin et al. 25. In their investigations on K562 cell lines, Bruecher et al. 14 demonstrated the presence of SHP-1 in a complex with both p210 and p190 BCR-ABL, exerting a direct inhibitory effect on BCR-ABL and BCR-ABL-associated phosphoryl proteins, thus prompting cellular differentiation. Among the BCR-ABL-associated downstream signaling pathways is the Jak/Stat pathway, the constitutive activity of which was proven to contribute to the development and progression of CML 26. SHP-1 is known to induce a significant suppressive effect on the Jak/Stat signaling components 27, together with enhancement of the proteasome-mediated degradation of Jak kinases, thus leading to suppression of cancer cell growth 28. Furthermore, SHP-1 has been shown to mediate PPA2-induced BCR-ABL proteasome degradation, with CML-BP progenitors lacking this tumor suppressor mechanism 29. In view of this, and taking into consideration the increase of PTP-1B expression upon initial BCR-ABL transformation, to balance its oncogenic effect, as observed by La Montagne et al. 30, it could be postulated that an initial upregulation of SHP-1 expression in early CML compared with normal BM cells is an attempt to interact with BCR-ABL and induce its phosphorylation to counteract its elevated PTK activity 25.

The marked decrease in SHP-1 mRNA levels associated with AD phases of CML (AP and BP) relative to CP observed in our study and in those of others 25 suggests that the diminished negative regulatory effect exerted by SHP-1 on BCR-ABL and its related phosphoryl proteins leads to uncontrolled kinase activity and disease progression. In support of this is the marked decrease in the levels of SHP-1 mRNA and protein observed in several types of aggressive malignant lymphomas 31. The mechanisms of this downregulation during CML progression are not completely understood and await further investigation. Gene silencing by methylation has been implicated but controversial data exist, some supporting it 32, 33, whereas others reporting decreased SHP-1 mRNA levels irrespective of gene methylation 25. The possibility of DNA deletions or single-base mutations was also speculated but none could be detected in any of the studies carried out 10. Of note, the present study showed that the SHP-1 mRNA levels were not dependent on any patients’ clinical or laboratory data in all phases of CML, being statistically not correlated to any of them.

In our cohort of patients, those with CP-CML received IM, the PKI, as the standard front-line therapy 5. Despite the impressive rates of the responding patients recorded by studies, some CML patients show primary resistance to IM 5,18. Although some clinical and biological characteristics have been linked to a lower probability of a response to IM, at present no reliable markers to predict the unresponsiveness to IM have yet been identified. The evaluation of the short-term response to IM may represent a sort of in-vivo test for sensitivity to therapy and could help identify patients less likely to benefit from IM treatment 34. We therefore assessed the response to IM in the 56 CP-CML patients included in the study after 18 months from the start of therapy, according to the protocol proposed by ELN 22, taking MMR as the goal event, as molecular response is nowadays considered more relevant to the issue of treatment discontinuation without a relapse or cure 35. An optimal response was achieved by 30 of 56 patients (53%), whereas a suboptimal response and treatment failure were observed in 10 (18%) and 16 (29%) patients, respectively; a treatment outcome comparable with that reported by the IRIS trial 5. In this context, it is noteworthy that ‘failure’ means that continuing of the IM treatment at the current dose is no longer appropriate and the patient would likely benefit from other forms of therapy, whereas a ‘suboptimal response’ implies that the patient may still have a substantial benefit from continuing IM, but the long-term outcome would not likely be favorable 22. Therefore, early identification of such patients could help in the decision of appropriate therapy.

In our study, the baseline level SHP-1 mRNA in patients with CP-CML correlated with the IM treatment outcome, wherein patients with an optimal response expressed SHP-1 mRNA at highly significantly higher levels compared with suboptimal responders and those who failed treatment. Furthermore, on stratifying the patients according to the SHP-1 levels, taking the median as a cutoff value, high SHP-1 expressors had a significantly higher probability to achieve MMR compared with low expressors (P<0.01). These findings are in accordance with those reported by Esposito et al. 36. Of note, the Sokal RR has been reported to predict molecular response 5, and the results of the present study confirm the correlation between lower Sokal risk scores and better IM treatment response; however, no correlation was found between the SHP-1 levels and Sokal risk score, implying that SHP-1 levels exert an independent impact on the treatment response. These data suggest that the SHP-1 level is a potentially important marker at diagnosis, capable of predicting MMR at 18 months in IM-treated CP-CML patients. Moreover, the decreased SHP-1 levels observed in AP-CML and BP-CML patients may play a role in the IM resistance reported in such patients.

The mechanisms by which the downregulation of SHP-1 levels seems to influence the IM response are still under investigation. Samanta et al. 37 reported that the SET-PP2A-SHP-1 pathway is involved in the activation of Lyn kinase downstream of Jak2 and that the enhancement of this pathway activity deactivates Lyn kinase, causing apoptosis in IM-resistant cells from CML patients. Esposito et al. 36 documented the decreased SHP-1 expression in IM-resistant cell lines relative to sensitive ones, due to hypermethylation of the promoter region, with the SHP-1 ectopic expression restoring the interaction between SHP-1 and SHP-2, which is a positive regulator of the RAS/MAPK signaling pathway essential for proliferation and viability signals, resulting in IM responsiveness. Taken together, these data suggest that SHP-1 plays an important role in BCR-ABL-independent IM resistance, which is strongly implicated in primary IM resistance.


  Conclusion Top


The present study documents the decreased SHP-1 expression in AD-CML patients relative to CP patients, offering one possible explanation for CML progression. It also links initial lower SHP-1 levels in CP-CML to a poorer response to IM treatment. Further large-scale investigations are warranted to validate such a relation and to evaluate the possibility of utilization of the baseline SHP-1 level as a predictor of the IM response, allowing for the early definition of patients not likely to benefit from IM therapy, for optimization of IM use and better ‘tailored’ target therapy.[37]

 
  References Top

1.Ren R. Mechanisms of BCR-ABL in the pathogenesis of chronic myeloid leukemia. Nat Rev cancer. 2005;5:172–173  Back to cited text no. 1
    
2.Druke BJ, Tamura S, Buchdunger E, Ohno S, Segal GM, Fanning S, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of BCR-ABL positive cells. Nat Med. 1996;2:561–566  Back to cited text no. 2
    
3.Savage DG, Antman KH. Imatinib mesylate: a new oral targeted therapy. N Engl J Med. 2002;346:683–693  Back to cited text no. 3
    
4.Melo JV, Barnes DJ. Chronic myeloid leukemia as a model of disease evolution in human cancer. Nat Rev Cancer. 2007;7:441–453  Back to cited text no. 4
    
5.Druker BJ, Guilhot F, O’Brien SG, Gathmann I, Kantarijan H, Gattelrmann N, et al. Five-year follow up of patients receiving imatinib for chronic myeloid leukemia. N Engl J Med. 2006;355:2408–2417  Back to cited text no. 5
    
6.Sureda A, Carrasco M, De Mighel M, Martinez JA, Conde E, Sanz MA, et al. Imatinib mesylate as treatment for blastic transformation of Philadelphia chromosome positive chronic myeloid leukemia. Haematologica. 2003;88:1213–1220  Back to cited text no. 6
    
7.Quintas-Cardama A, Kantarijan HM, Cortes JE. Mechanisms of primary and secondary resistance to imatinib in chronic myeloid leukemia. Cancer Control. 2009;16:122–131  Back to cited text no. 7
    
8.Tonks NK, Neel BG. From form to function: signaling by protein tyrosine phosphatases. Cell. 1996;87:365–368  Back to cited text no. 8
    
9.Neel BG. Structure and function of SH2-containing tyrosine phosphatases. Semin Cell Biol. 1993;4:419–432  Back to cited text no. 9
    
10.Wu C, Sun M, Liu L, Zhou GW. The function of the protein tyrosine phosphatase SHP-1 in cancer. Gene. 2003;306:1–12  Back to cited text no. 10
    
11.Chin CS, Wong KY, Loong F, Srivastava G. SOCs 1 and SHP-1 hypermethylation in mantle cell lymphoma and follicular lymphoma: implications for epigenetic activation of the Jak/Stat pathway. Leukemia. 2004;18:356–358  Back to cited text no. 11
    
12.Gauffin F, Diffner E, Gustafsson B, Nordgren A, Wingren AG, Sander B, et al. Expression of PTEN and SHP-1, investigated from tissue microarrays in pediatric acute lymphoblastic leukemia. Pediatr Hematol Oncol. 2009;26:48–56  Back to cited text no. 12
    
13.Kharbanda S, Bharti A, Pei D, Wang J, Pendey P, Ren R, et al. The stress response to ionizing radiation involves c-ABL-dependent phosphorylation on SHPTP1. Proc Natl Acad Sci USA. 1996;93:6898–6901  Back to cited text no. 13
    
14.Bruecher-Encke B, Griffin JD, Neel BG, Lorenz U. Role of the tyrosine phosphatase SHP-1 in K562 cell differentiation. Leukemia. 2001;15:1424–1432  Back to cited text no. 14
    
15.Sandberg AA, Bridge JA. Techniques in cancer cytogenetics: an overview and update. Cancer Invest. 1992;10:163–172  Back to cited text no. 15
    
16.Primo D, Tabernero MD, Rasillo A, Sayaques M, Espinoso AB, Chillon MC, et al. Patterns of BCR/ABL gene rearrangements by interphase fluorescence in situ hybridization (FISH) in BCR/ABL+ leukemias: incidence and underlying genetic abnormalities. Leukemia. 2003;17:1124–1129  Back to cited text no. 16
    
17.Jones CD, Yeung C, Zehnder JL. Comprehensive validation of a real-time quantitative bcr-abl assay for clinical laboratory use. Am J Clin Path. 2003;120:42–48  Back to cited text no. 17
    
18.Lahaye T, Riehm B, Berger U, Paschka P, Muller CS, Kreil S, et al. Response and resistance in 300 patients with BCR-ABL positive leukemias treated with imatinib in a single center: a 4–5 year follow up. Cancer. 2005;103:1659–1669  Back to cited text no. 18
    
19.Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Roberston JE, et al. Prognostic discrimination in ‘good-risk’ chronic granulocytic leukemia. Blood. 1984;63:789–799  Back to cited text no. 19
    
20.Branford S, Hughes T. Detection of BCR-ABL mutations and resistance to imatinib mesylate. Methods Mol Med. 2006;125:93–106  Back to cited text no. 20
    
21.Hehlmann R. How I treat CML blast crisis. Blood. 2012;120:737–747  Back to cited text no. 21
    
22.Baccarani M, Cortes J, Pane F, Neiderwiesser D, Sagilo G, Apperli J, et al. Chronic myeloid leukemia: an update of concepts and management recommendations of European LeukemiaNet. J Clin Oncol. 2009;27:6041–6051  Back to cited text no. 22
    
23.Livak KJ, Schmittgen TD. Analysis of relative gene expression delta using real time quantitative PCR and the 2−&Dgr;&Dgr;CT method. Methods. 2001;25:402–408  Back to cited text no. 23
    
24.Rieu I. Real time quantitative RT-PCR: design, calculations and statistics. Plant Cell. 2009;21:1031–1033  Back to cited text no. 24
    
25.Amin HM, Hoshino K, Yang H, Lin Q, Lai R, Garcia-Manero G. Decreased expression level of SH2 domain-containing protein tyrosine phosphatase-1 (SHP-1) is associated with progression of chronic myeloid leukemia. J Pathol. 2007;212:402–410  Back to cited text no. 25
    
26.Xie S, Wang Y, Liu J, Sun T, Wilson MB, Smithgall TE, et al. Involvement of Jak2 tyrosine phosphorylation in BCR-ABL transformation. Oncogene. 2001;20:488–495  Back to cited text no. 26
    
27.David M, Chen HE, Goelz S, Larner AC, Neel BG. Differential regulation of α/β-interferon-stimulated Jak/Stat pathway by the SHPTP1. Mol Cell Biol. 1995;15:7050–7058  Back to cited text no. 27
    
28.Wu C, Guan Q, Wang Y, Zhao ZJ, Zhou GW. SHP-1 suppresses cancer cell growth by promoting degradation of Jak kinases. J Cell Biochem. 2003;90:1026–1037  Back to cited text no. 28
    
29.Neviani P, Santhanam R, Trotta R, Notari M, Blaser BW, Liu S, et al. The tumor suppressor PP2A is functionally inactivated in blast crisis chronic myeloid leukemia through the inhibitory activity of the BCR/ABL-regulated SET protein. Cancer Cell. 2005;8:355–368  Back to cited text no. 29
    
30.La Montagne KR, Flint AJ, Franza BR, Pendergast AM, Tonks NK. Protein tyrosine phosphatase 1 B antagonizes signaling by oncoprotein tyrosine kinase p210 BCR-ABL in vivo. Mol Cell Biol. 1998;18:2965–2975  Back to cited text no. 30
    
31.Oka T, Yoshino T, Hayashi K, Ohara N, Nakanishi T, Yamaai Y, et al. Reduction of hematopoietic cell-specific tyrosine phosphatase SHP-1 gene expression in natural killer cell lymphoma and various types of lymphomas/leukemias: combination analysis with cDNA expression array and tissue microarray. Am J Pathol. 2001;159:1495–1505  Back to cited text no. 31
    
32.Oka T, Ouchida M, Koyama M, Ogama Y, Yakada S, Nakatani Y, et al. Gene silencing of tyrosine phosphatase SHP-1 gene by aberrant methylation in leukemias/lymphomas. Cancer Res. 2002;62:6390–6394  Back to cited text no. 32
    
33.Uhm KO, Lee ES, Lee YM, Parke JS, Kim SJ, Kim BS, et al. Differential methylation pattern of ID4, SFRP1 and SHP-1 between acute myeloid leukemia and chronic myeloid leukemia. J Korean Med Sci. 2009;24:493–497  Back to cited text no. 33
    
34.Volpe G, Panuzzo C, Ulisciani S, Cilloni D. Imatinib resistance in chronic myeloid leukemia. Cancer Lett. 2009;247:1–9  Back to cited text no. 34
    
35.Guilhot J, Bacarrani M, Clark RE, Cervantes F, Guilhot F, Hochhaus A, et al. Definitions, methodological and statistical issues for phase 3 trials in chronic myeloid leukemia: a proposal by the European LeukemiaNet. Blood. 2012;119:5962–5971  Back to cited text no. 35
    
36.Esposito N, Colavita I, Quintarelli C, Sica AR, Peluso AL, Luciano L, et al. SHP-1 expression accounts for resistance to imatinib treatment in Philadelphia chromosome positive cells derived from patients with chronic myeloid leukemia. Blood. 2011;118:3633–3644  Back to cited text no. 36
    
37.Samanta AK, Chakraborty SN, Wang Y, Kantarijian H, Sun X, Hood J, et al. Jak2 inhibition deactivates Lyn kinase through the SET-PP2A-SHP1 pathway, causing apoptosis in drug-resistant calls from chronic myelogenous leukemia patients. Oncogene. 2009;28:1669–1681  Back to cited text no. 37
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusion
Introduction
Patients and methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1084    
    Printed22    
    Emailed0    
    PDF Downloaded101    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]