• Users Online: 24
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 41  |  Issue : 3  |  Page : 111-115

Lower Fas-associated phosphatase-1 expression predicted poor outcome in acute myeloid leukemia patients


1 Haematology Unit, Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Menoufia, Egypt
2 Department of Clinical Pathology, Shebin El Kom Teaching Hospital, Shebin El Kom, Egypt
3 Department of Haemato-Oncology, National Cancer Institute, Cairo, Egypt
4 Department of Biochemistry, National Liver Institute, Menoufia University, Menoufia, Egypt
5 Department of Clinical Pathology, Menoufia University, Menoufia, Egypt

Date of Submission03-May-2016
Date of Acceptance09-Jun-2016
Date of Web Publication27-Dec-2016

Correspondence Address:
Nahla F.A. Osman
Haematology Unit, Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Shebin El Kom
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1110-1067.196175

Rights and Permissions
  Abstract 

Background Fas-associated phosphatase-1 (FAP-1) mediates tumor suppressor and tumor promoter effects through the inhibition of oncogenic tyrosine kinases and apoptosis, respectively. It was claimed responsible for the pathogenesis of some cancers; nevertheless, its role in acute myeloid leukemia (AML) is not clear.
Patients and Methods FAP-1 expression was measured in 20 new AML patients and 12 apparently healthy individuals using real-time PCR.
Results FAP-1 expression was significantly lower in AML patients compared with controls (P<0.001). Patients with relatively higher FAP-1 expression had significantly higher hemoglobin and platelets but lower white cell count (WCC) and lactic dehydrogenase (LDH) (P<0.001), thus reflecting lower tumor burden in this group. Patients’ response was assessed on day 28 after chemotherapy; we found that one of seven patients with FAP-1 expression up to 0.03945 achieved complete remission (CR) compared with eight of 13 patients with levels more than 0.03945. FAP-1 levels predicted the response in the subgroup with normal karyotype and in those with no FLT3-ITD as the majority of those with higher levels achieved CR (77.8 and 80%, respectively), whereas CR was seldom achieved in those with low levels.
Conclusion Our data showed significantly reduced FAP-1 expression in AML patients. FAP-1 can be a useful tool in identifying patient’s risk in AML as the level of expression predicted the response.

Keywords: acute myeloid leukemia, Fas-associated phosphatase-1, gene expression, real-time polymerase chain reaction, response


How to cite this article:
Osman NF, Alzobary WM, Samra MA, Alsaid HH, Eltounsi IA. Lower Fas-associated phosphatase-1 expression predicted poor outcome in acute myeloid leukemia patients. Egypt J Haematol 2016;41:111-5

How to cite this URL:
Osman NF, Alzobary WM, Samra MA, Alsaid HH, Eltounsi IA. Lower Fas-associated phosphatase-1 expression predicted poor outcome in acute myeloid leukemia patients. Egypt J Haematol [serial online] 2016 [cited 2020 Aug 5];41:111-5. Available from: http://www.ehj.eg.net/text.asp?2016/41/3/111/196175


  Introduction Top


Fas-associated phosphatase-1 (FAP-1) is a high molecular weight nonreceptor protein tyrosine phosphatase that removes phosphate groups from phosphorylated tyrosine residues and is widely expressed in almost all tissues [1]. FAP-1 mediates diverse cellular functions. It exerts tumor-promoting and tumor-suppressing effects through its inhibitory interaction with the death domain Fas and by counteracting the activity of oncogenic tyrosine kinases. It was incriminated in the pathogenesis of a number of malignancies [1],[2],[3],[4],[5],[6].

This study aimed to explore the role of FAP-1 in the pathogenesis of acute myeloid leukemia (AML) and correlate it with clinical disease characteristics.


  Patients and methods Top


The study included 20 de-novo AML patients who presented during the period between December 2014 and April 2015. The study also included 12 healthy controls. Diagnosis of AML was carried out on bone marrow samples and confirmed by means of flow cytometry using the acute panel. Conventional karyotyping and detection of FLT3 mutation using conventional PCR were carried out as a part of routine diagnostic workup.

After obtaining consent from patients, relevant clinical data and blood samples were collected. RNA was extracted from EDTA blood samples using QIAamp RNA Blood Mini Kits (Qiagen, Hilden, Germany). QIAamp spin columns uses the selective binding properties of silica-based membrane to RNA, which yields total cellular RNA from fresh whole blood and other sample sources using a specialized high-salt buffering system. The concentration and purity of extracted total RNA was measured using NanoDrop (2000 Spectrophotometer; Thermo Scientific, USA) by measuring the absorbance (A) at 260 and 280 nm. The A260/A280 should be around 2. Reverse transcription was carried out using QuantiTect cDNA Reverse Transcription Kits (catalog no. 205311; Applied Biosystems, California, USA) using Gene Amp PCR System (model 9700; Applied Biosystems). Reverse transcription was carried out in two steps: (i) genomic DNA elimination by adding variable volumes of template RNA and RNase-free water (depending on the RNA concentration) to 4 μl of gDNA wipeout buffer and incubating the mixture at 42C° for 8 min, and (ii) reverse transcription of RNA to generate single stranded cDNA. The master mix comprised 1 μl of QuantiTect reverse transcriptase, 4 μl of QuantiTect RT buffer, 1 μl of the supplied RT primer, and 14 μl of template RNA (total volume 20 μl). The tubes were incubated in the thermal cycler for 30 min at 42°C and for 3 min at 95°C to inactivate the enzyme. cDNA was stored at −20°C. A temperature gradient experiment using conventional PCR was carried out to identify the annealing temperature for FAP-1 gene amplification. The reaction mix comprised 12.5 μl of master mix, 1 μl of each of the sense and antisense FAP-1 primers listed below, 2 μl of template DNA, and DNase-free water, to make a total volume of 25 μl. The program used in the temperature gradient thermal cycler included initial denaturation at 94°C for 3 min followed by repeated 35 cycles as follows: denaturation at 94°C, annealing at six different temperatures of 51, 53, 55, 57, and 62°C, and extension at 72°C each for 1 min. Gel electrophoresis showed 59°C to be the most suitable annealing temperature with least nonspecific amplification bands ([Figure 1]).
Figure 1 Gel electrophoresis of temperature gradient experiment. C, control sample; 1, DNA of case 1.

Click here to view


The real-time PCR for FAP-1 gene expression analysis was carried out on cDNA using QuantiTect Sybr Green PCR Kit (Applied Biosystems, California). Primers were designed to amplify 358 bp of FAP-1 gene (sense: CCTACAGTGTGGGGTC; antisense: GGTGAACCATCGCAGT) and the endogenous control PBGD (sense: AGAGTGATTCGCGTGGGTACC; antisense: CCCTGTGGTGGACATAGCAAT). The reaction mixture comprised 12.5 μl of master mix, 1 μl of each of the four primers, and 6.5 μl of the DNase-free water (total volume 23 μl). The wells were loaded on real-time PCR thermal cycle (model 7500; Applied Biosystems) with 96-well platform and three-color system. The thermal cycles were as follows: initial denaturation for 15 min at 95°C followed by 45 repeated cycles of 15 s at 94°C, 30 s at 59°C, and 30 s at 72°C ([Figure 2]).
Figure 2 DNA created using the real-time PCR as measured by the fluorescence. (a) Target gene; (b) control gene.

Click here to view


The principle of calculation of gene expression

The comparative Ct (ΔΔCt) method was used to determine the relative target quantity in samples (ΔΔCtCtcase−ΔCtcontrol). With the comparative Ct method, the 7500 software measures the amplification of the target and of the endogenous control in patients’ samples and in reference samples. Measurements were normalized using the endogenous control (ΔCtcase/control=CtFAP-1CtPBGD). FAP-1 expression was expressed as fold change (= 2−ΔΔCt).

Statistical analysis

Analysis was performed using IBM SPSS Statistics for Windows (version 22.0; IBM). Comparisons of categorical data were made using the χ2-test and the Fisher exact test, as appropriate. Student’s t-test and the Mann–Whitney test were used to test the significance. Spearman’s correlation coefficient (r) was used to measure the association between two quantitative variables. Receiver–operator characteristic (ROC) curve was used to identify the best FAP-1 cutoff that can predict the response in AML patients.


  Results Top


FAP-1 expression was significantly lower in AML patients (mean: 0.1932±0.2404) when compared with the control group (mean: 1.0±0.0) (P<0.001) ([Table 1] and [Figure 3]).
Table 1 Level of Fas-associated phosphatase-1 expression in patients and controls

Click here to view
Figure 3 Levels of Fas-associated phosphatase-1 expression in patients and control.

Click here to view


There was a positive correlation between FAP-1 expression and hemoglobin level and platelet count but a negative correlation with white blood cell counts (r=0.757, 0.790, and −0.648, respectively; P<0.001). We also demonstrated a negative correlation between FAP-1 expression and LDH and serum creatinine (r=−0.697 and −0.676, respectively; P<0.001).

ROC curve identified 0.03945 as the best cutoff level of FAP-1 expression in predicting the response in AML, with a sensitivity of 88.9% but lower specificity at 54.5%. At that cutoff point, the negative predictive value was 85% and the positive predictive value was 61.5%.

On day 28 after chemotherapy, nine patients were in complete remission (CR), whereas 11 failed to achieve remission when the response was assessed with full blood count and bone marrow examination (morphologically and by means of flow cytometry). Study of the patients’ response in relation to FAP-1 expression showed that one of seven patients with FAP-1 expression up to 0.03945 achieved CR compared with eight of 13 patients with levels more than 0.03945 (P=0.04) ([Figure 4]).
Figure 4 Fas-associated phosphatase-1 expression in relation to response to chemotherapy. CR, complete remission.

Click here to view


In the subgroup of 11 patients with normal karyotype, nine had FAP-1 expression more than 0.03945 and of them seven (77.7%) achieved CR. However, the two patients with FAP-1 levels up to 0.03945 were not in CR when assessed (P=0.04).

Similarly, in those with no FLT3-internal tandom duplicate (ITD) (n=8), four of five patients with FAP-1 expression above the cutoff level had responsive disease compared with none of the three patients with lower levels who were refractory to therapy (P=0.03) ([Table 2]).
Table 2 Level of Fas-associated phosphatase-1 expression in relation to response in the subgroup with normal karyotype and the subgroup with no FLT3-ITD

Click here to view


In this study, there was no significant difference in FAP-1 expression between different FAB subtypes or between patients with hepatosplenomegaly and those with no organomegaly. There was also no correlation between FAP-1 expression and blast percentage both in the peripheral blood and the bone marrow.


  Discussion Top


The recent leap in identifying the cytogenetic and the molecular events associated with AML has revolutionized our understanding of the nature of the disease, which was reflected on patient management and consequently on the outcome; nevertheless, there is a need for significant improvement as the long-term survival in young nonacute promyelocytic-AML patients is between 30 and 60% depending on the cytogenetic and FLT3 mutation status and is clearly worse in older patients [7].

To our knowledge, this is the first report on the impact of FAP-1 on the pathogenesis and outcome in de-novo AML. We hypothesized that FAP-1 can play a role in the process of leukemogenesis through its protein tyrosine phosphatase activity and/or apoptosis regulation.

The present study was designed to evaluate the role FAP-1 gene expression in AML. We demonstrated significantly lower levels of FAP-1 mRNA in patients with AML compared with age-matched controls. We suggest that the decreased expression of FAP-1 in AML is associated with increased tyrosine kinase activity as a consequence of loss of FAP-1 action as a protein tyrosine phosphatase (i.e. loss of FAP-1 inhibitory effect on the signal transduction from growth factor receptors and/or oncogenes with tyrosine kinase activity). This FAP-1 effect can suppress tumor occurrence.

Low expression of FAP-1 has also been reported in other hematological and nonhematological malignancies, including MDS [4], lymphoma [6], a proportion of hepatocellular carcinoma [5], breast cancer [8], and in squamous cell carcinoma of the lung [3]. Low FAP-1 expression was claimed to be associated with increased Src kinase activity in breast cancer and STAT3 activity in lung squamous cell carcinoma, and hence is involved in the tumorigenesis [3],[8].

In contrast, higher FAP-1 expression was reported in Bcr-Abl transfected myelomonocytic cells and was considered responsible for increased β-catenin activity, which correlates with leukemia stem cell expansion and disease progression in chronic myeloid leukemia. Blocking the action of FAP-1 by the tripeptide SLV decreased β-catenin activity and overcame Fas-resistance in those cells [9]. Increased FAP-1 expression was also reported in ovarian and colorectal cancer and was thought to confer resistance to Fas-induced apoptosis [10],[11].

He et al. [12] suggested that the impact of FAP-1 on cancer is divided between its capacity to counteract the activity of oncogenic tyrosine kinases and its inhibitory interaction with the death receptor, Fas. The ability of FAP-1 to inhibit signaling from growth factor receptors or oncogenes with tyrosine kinase activity can suppress tumor occurrence. FAP-1 expression is regulated, at least partially, by the pattern of gene promoter methylation [6].

Our results showed that lower FAP-1 mRNA levels were associated with features of increased tumor burden as reflected by significantly lower hemoglobin levels and platelet count but higher WCC, LDH, and serum creatinine in the group with relatively low FAP expression. This is likely due to lack of the tumor suppressor effect of FAP-1.

FAP-1 expression predicted the response in our patients as CR was seldom achieved in those with levels below or equal to the cutoff, whereas higher expression was associated with a good chance to achieve remission on day 28 of chemotherapy. This can be explained at least partially by increased tumor burden associated with lower levels of FAP-1 expression. In addition, we suggest that residual FAP-1 activity is important for the antiproliferative effect of chemotherapy in AML patients.

AML with normal karyotype is usually grouped in the ‘intermediate risk’ category, although the treatment outcome is extremely heterogeneous. Our results suggest that FAP-1 expression can be used to risk stratify these patients as it helps in differentiating this heterogeneous category into prognostically different subgroups. Similarly, in AML patients with no FLT3-ITD mutation, FAP-1 expression predicted the response to therapy and can be a useful tool to refine risk stratification within this group.

ROC curve has shown FAP-1 expression as a good negative test as it can predict the group that is likely to fail to achieve CR after to first chemotherapy and who might benefit from investigational therapy.


  Conclusion Top


We demonstrated lower FAP-1 mRNA in AML patients compared with controls. These findings suggest that decreased FAP-1 expression can be a contributing factor in the pathogenesis of AML. FAP-1 has prognostic implication, as levels of expression correlated with the disease response to chemotherapy, and thus can be integrated in a risk stratification model. This is particularly relevant when other prognostic markers are not informative (e.g. in the subgroup with normal karyotype). FAP-1-modulating agents should be investigated as a possible therapeutic option.

Acknowledgements

The project was funded by Menoufia University Research Grant.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Goebel-Goody SM, Wilson-Wallis ED, Royston S, Tagliatela SM, Naegele JR, Lombroso PJ. Genetic manipulation of STEP reverses behavioral abnormalities in a fragile X syndrome mouse model. Genes Brain Behav 2012;11:586–600.  Back to cited text no. 1
    
2.
Abaan OD, Toretsky JA. PTPL1: a large phosphatase with a split personality. Cancer Metastasis Rev 2008;27:205–214.  Back to cited text no. 2
    
3.
Han XJ, Xue L, Gong L, Zhu SJ, Yao L, Wang SM et al. Stat3 inhibits PTPN13 expression in squamous cell lung carcinoma through recruitment of HD AC5. Biomed Res Int 2013;2013:468963.  Back to cited text no. 3
    
4.
Mundle SD, Mativi BY, Bagai K, Feldman G, Cheema P, Gautam U et al. Spontaneous down-regulation of Fas-associated phosphatase-1 may contribute to excessive apoptosis in myelodysplastic marrows. Int J Hematol 1999;70:83–90.  Back to cited text no. 4
    
5.
Yeh SH, Wu DC, Tsai CY, Kuo TJ, Yu WC, Chang YS et al. Genetic characterization of fas-associated phosphatase-1 as a putative tumor suppressor gene on chromosome 4q21.3 in hepatocellular carcinoma. Clin Cancer Res 2006;12:1097–1108.  Back to cited text no. 5
    
6.
Ying J, Li H, Cui Y, Wong AH, Langford C, Tao Q. Epigenetic disruption of two proapoptotic genes MAPK10/JNK3 and PTPN13/FAP-1 in multiple lymphomas and carcinomas through hypermethylation of a common bidirectional promoter. Leukemia 2006;20:1173–1175.  Back to cited text no. 6
    
7.
Estey EH. Acute myeloid leukemia: 2013 update on risk-stratification and management. Am J Hematol 2013;88:318–327.  Back to cited text no. 7
    
8.
Glondu-Lassis M, Dromard M, Lacroix-Triki M, Nirdé P, Puech C, Knani D et al. PTPL1/PTPN13 regulates breast cancer cell aggressiveness through direct inactivation of Src kinase. Cancer Res 2010;70:5116–5126.  Back to cited text no. 8
    
9.
Huang W, Bei L, Eklund EA. Fas-associated phosphatase 1 (Fap1) influences βcatenin activity in myeloid progenitor cells expressing the Bcr-abl oncogene. J Biol Chem 2013;288:12766–12776.  Back to cited text no. 9
    
10.
Meinhold-Heerlein I, Stenner-Liewen F, Liewen H, Kitada S, Krajewska M, Krajewski S et al. Expression and potential role of Fas-associated phosphatase-1 in ovarian cancer. Am J Pathol 2001;158:1335–1344.  Back to cited text no. 10
    
11.
Yao H, Song E, Chen J, Hamar P. Expression of FAP-1 by human colon adenocarcinoma: implication for resistance against Fas-mediated apoptosis in cancer. Br J Cancer 2004;91:1718–1725.  Back to cited text no. 11
    
12.
He RJ, Yu ZH, Zhang RY, Zhang ZY. Protein tyrosine phosphatases as potential therapeutic targets. Acta Pharmacol Sin 2014;35:1227–1246.  Back to cited text no. 12
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1021    
    Printed24    
    Emailed0    
    PDF Downloaded100    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]