• Users Online: 1325
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 44  |  Issue : 1  |  Page : 6-13

CYP2B6 polymorphism and lipoprotein lipase expression in chronic lymphocytic leukemia: impact on the outcome of fludarabine–cyclophosphamide regimen


1 Hematology Department, Medical Research Institute, Alexandria University, Alexandria, Egypt
2 Clinical Pathology Department, Military Medical Academy, Cairo, Egypt

Date of Submission31-Aug-2018
Date of Acceptance20-Mar-2019
Date of Web Publication27-Sep-2019

Correspondence Address:
Ahmed M.L Bedewy
Medical Research Institute, Alexandria University, Abraj Al-Shaker, Zaky Ragab Street, Smouha, Alexandria, 21615
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ejh.ejh_32_18

Rights and Permissions
  Abstract 


Background Chronic lymphocytic leukemia (CLL) is the most common type of leukemia and has a highly variable clinical course. Cyclophosphamide (CPA)-containing regimens are the standard of care for patients lacking the 17p deletion. CYP2B6 is a polymorphic cytochrome P450 isoform that converts CPA to its active form. Lipoprotein lipase (LPL) catalyzes the hydrolysis of triacylglycerol. Remarkably, a growing body of data emphasizes its role in the biology of different tumors.
Objectives This study aimed to study CYP2B6 polymorphism and LPL expression in fludarabine cyclophosphamide (FC)-treated CLL patients lacking 17p deletion.
Methods 46 treatment-naïve CLL patients negative for 17p deletion and indicated to receive chemotherapy were enrolled. CYP2B6 genotyping and lipoprotein lipase mRNA expression were assayed by Realtime PCR. FC-protocol was given then treatment-related toxicities, response, and event free survival were traced.
Results CYP2B6*6 allele was associated with lower rates of treatment-related anemia and hospital admission. The response to FC was affected only by CYP2B6 polymorphism. The event-free survival of responders was significantly higher in patients having low LPL expression.
Conclusion CYP2B6*6 infers lower CPA efficacy with lower treatment-induced side effects and increased risk of nonresponding to FC chemotherapy in CLL. LPL expression is a predictor of outcome in CLL, indicating poor survival.

Keywords: chronic lymphocytic leukemia, cyclophosphamide, CYP2B6, lipoprotein lipase


How to cite this article:
Bedewy AM, El-Bendary WR. CYP2B6 polymorphism and lipoprotein lipase expression in chronic lymphocytic leukemia: impact on the outcome of fludarabine–cyclophosphamide regimen. Egypt J Haematol 2019;44:6-13

How to cite this URL:
Bedewy AM, El-Bendary WR. CYP2B6 polymorphism and lipoprotein lipase expression in chronic lymphocytic leukemia: impact on the outcome of fludarabine–cyclophosphamide regimen. Egypt J Haematol [serial online] 2019 [cited 2019 Oct 23];44:6-13. Available from: http://www.ehj.eg.net/text.asp?2019/44/1/6/268001




  Introduction Top


Chronic lymphocytic leukemia (CLL) is a blood and bone marrow disease that usually gets worse slowly. CLL is one of the most common types of leukemia in adults. It often occurs during or after middle age; it rarely occurs in children [1],[2].

CLL is a type of cancer in which the bone marrow makes too many lymphocytes. Although the majority of patients respond to initial therapy, the disease is incurable and runs a clinical course characterized by repeated recurrences culminating in drug resistance [3],[4].

Growth kinetics, response to therapy, and propensity for disease acceleration and transformation vary considerably between individual patients, and a large number of biological variables have been identified that correlate with adverse outcomes. These include advanced age, male sex, germline configuration of the immunoglobulin heavy-chain gene, mutation or deletion of TP53, and deletion of chromosome 11q [4],[5]. TP53 defects are strongly associated with chemoresistance but affect only a minority of previously untreated patients. Consequently, chemotherapy remains the backbone of modern frontline therapy for most patients [6],[7].

Although fludarabine/cyclophosphamide (FC) regimen is active in the majority of previously untreated patients with CLL, the complete response (CR) rate is only 23–38%, implying a degree of therapy resistance in a significant proportion of patients [8],[9]. Although it is clear that the efficacy of FC is influenced by disease-related factors such as TP53 mutation/deletion, such factors do not account for all patients who fail to achieve a CR. It is therefore relevant to consider other variables that might affect the pharmacokinetics or pharmacodynamics of the FC drug combination [10].

CYP2B6 is a polymorphic cytochrome P450 isoform that converts cyclophosphamide (CPA) to its active form. CPA is a prodrug that requires activation to its active metabolite, 4-hydroxycyclophosphamide (4OH-CPA), to exert its cytotoxic effects. 4OH-CPA, which readily diffuses into cells, is very unstable, and spontaneously decomposes into the alkylating agent phosphoramide mustard [5]. Among the several enzymes that are thought to convert CPA to 4OH-CPA, one of the most important is the cytochrome P450 isoform CYP2B6, which is expressed mainly in the liver [11],[12]. CYP2B6 gene is highly polymorphic, with more than 100 known single-nucleotide polymorphisms (SNPs) currently identified in humans. CYP2B6 SNPs have distinct ethnic frequencies and some have been linked to alterations in CYP2B6 expression and function [13],[14],[15]. There is some circumstantial evidence to suggest that CYP2B6 SNPs might be clinically important. For example, they have been implicated as possible determinants of treatment outcome in patients receiving CPA for lymphoma and breast cancer or as myeloablative conditioning before hematopoietic stem cell transplantation, although definitive evidence is lacking [16],[17].

Given the potential for functional interaction between individual SNPs, it is more meaningful to consider the genetic variants of CYP2B6 in terms of its 37 known alleles. Most of these alleles are rare but one (*6) is particularly common, with a frequency ranging from ∼25% in Whites to 60% in Asian populations [18].

CYP2B6*6 is characterized by the presence of two SNPs, c.516G>T in exon 4 (Q172H; rs3745274) and c.785A>G in exon 5 (K262R; rs2279343), and displays altered expression and function compared with the CYP2B6*1 wild-type allele. Specifically, *6 carriers express significantly reduced levels of CYP2B6 mRNA and protein [19],[20]. On the other hand, most reports have shown that the *6 allele is associated with a higher rate of CPA 4-hydroxylation [16],[20],[21]. The prediction of the overall impact of CYP2B6*6 expression on CPA pharmacokinetics and its therapeutic efficacy/toxicity is difficult to predict. The net outcome of the reduced enzyme expression on one side and the increased specific enzyme activity on the other side determine its effect [19].

Microarray studies identified distinct sets of genes expressed differentially in mutated versus unmutated CLL [22],[23] and lipoprotein lipase (LPL) was one of the several genes being overexpressed in unmutated cases. On the basis of these preliminary observations, together with ZAP-70 and other molecular markers, the role of LPL in CLL prognosis assessment was investigated by different groups. These studies indicated that LPL correlates closely with the clinical course and survival [24],[25]. Physiologically, LPL is expressed in the muscle, adipose tissue, macrophages, but not in normal T and B lymphocytes [26]. Bound to the capillary endothelium and released upon heparin, LPL catalyzes the hydrolysis of triacylglycerol of the circulating chylomicrons and very low density lipoproteins. Remarkably, a growing body of recent data indicates that lipid utilization and LPL function play an important role in the survival and metabolism of different tumors, including CLL [27],[28].

In light of these considerations, we sought to investigate the effect of CYP2B6*6 polymorphism and LPL expression on the efficacy and toxicity of FC protocol in CLL.


  Patients and methods Top


Forty-six patients were enrolled in this study. They were diagnosed to have CLL and were indicated to receive therapy according to the criteria. Exclusion criteria were: (a) age above 65 years, (b) presence of 17p deletion by FISH study, (c) any comorbidity not permitting FC regimen and (d) patients with unevaluable response to FC regimen.

Patients received FC protocol. Fludarabine (30 mg/m2/day intravenously) and CPA (250 mg/m2/day intravenously) were given on days 1–3 every 28 days, for a maximum of six courses. The first restaging was performed after three treatment courses. Therapy was continued only if a partial response or CR was noted at that time. A second and final restaging was performed after three additional courses of treatment [29]. Treatment-related toxicities were traced in patients. These included treatment-related anemia, thrombocytopenia, neutropenia, gastrointestinal complications, febrile episodes, and hospital admission between cycles. Clinical response was defined according to the revised guidelines of the National Cancer Institute-sponsored workshop [30]. The procedures followed were according to the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2008. Confidentiality of data was assured for all the patients.

CYP2B6 genotyping

The CYP2B6 516G>T polymorphism was genotyped using a commercially available TaqMan real-time PCR SNP genotyping assay (Applied Biosystems, Carlsbad, California, USA). CYP2B6 785A>G polymorphism was assayed by TaqMan SNP genotyping assay designed to specifically detect the CYP2B6 gene without amplification of its homologous pseudogene CYP2B7. The sequences of primers and probes were as follows: TGGAGAAGCACCGTGAAACC (forward), TGGAGCAGGTAGGTGTCGAT (reverse), VIC-CCCCCAAGGACCTCMGB (wild type), FAM-CCCCAGGGACCTC-MGB (mutant) [31].

RT PCR analysis of LPL mRNA peripheral blood samples of CLL patients and two healthy controls were used for total RNA isolation by TRIzol (Life Technologies; Carlsbad, CA, USA) extraction method followed by reverse transcription. Quantitative PCR was performed by LightCycler 480 real-time PCR system with SYBR-Green (Roche, Germany) detection format: LPL-F: 5′-CCGCCGACCAAAGAAGAGAT-3′, LPL-R: CAATGACATTGGAGTCTGGTTCTCTC-3′, ABL-4F: 5′-GGGCTCATCACCACGCTCCA-3′, ABL-6F: 5′-CTGCCG GTTGCACTCCCTCA-3′ [32].

The relative LPL to ABL1 expression level was calculated by the ΔCt method (ΔCt=CtLPL−CtABL1). LPL/ABL1 expression in patients were normalized to the expression found in healthy control samples using the ΔΔCt method after efficiency validation of the target and reference gene PCRs [33].

Statistical analysis

All statistical analyses were carried out using SPSS (version 20, SPSS Inc., Chicago, IL, USA). Categorical data were summarized using frequency counts and tested using the χ2 or Fisher’s exact test. Continuous data were summarized using mean and SD (for age of patients). Odds ratio was calculated for risk estimation with 95% confidence interval. Kaplan–Meier survival analysis was used for the estimation of event-free survival.


  Results Top


Our results cleared that there was no significant association between CYP2B6 polymorphism and age, sex, Binet stage, B2MG, lactate dehydrogenase (LDH), treatment-related anemia, thrombocytopenia, neutropenia, febrile episodes, gastrointestinal complications, or LPL expression. No patients with variant CYP2B6 genotype (*1/*6 and *6/*6) required hospital admission for more than 3 days in between cycles while 31% of CYP2B6*1/*1 patients underwent such admission. This was a significant association between wild-type CYP2B6 and interim hospital admission (P=0.009). CYP2B6 variant genotype was associated with a lower chance of achieving response to FC protocol (P=0.035; [Table 1]).
Table 1 CYP2B6 genotype in relation to the studied parameters

Click here to view


LPL expression equal to or above the median value was considered high (n=23), while expression levels below the median value were considered low (n=23). LPL expression was not associated with age, sex, Binet stage, treatment-related anemia, thrombocytopenia, neutropenia, febrile episodes, interim hospital admission, gastrointestinal complications, or response to FC protocol. High LPL expression was associated with elevated serum LDH and B2MG levels (P=0.008 for both; [Table 2]). The type of response to FC protocol was not associated with any of the studied parameters except for the CYP2B6 genotype where patients with the wild-type *1/1* have higher chances of achieving response to chemotherapy (P=0.035; [Table 3]). Having the *6 allele pertained a higher risk of failing to respond to FC protocol (odds ratio=4.375, 95% confidence interval: 1.046–18.265, P=0.042).
Table 2 Lipoprotein lipase expression (high vs. low) in relation to the studied parameters

Click here to view
Table 3 Response of the patients to fludarabine/cyclophosphamide protocol according to the studied parameters

Click here to view


Event-free survival of responders (35 patients) through a follow-up period that ranged from 14 to 28 months (median=20 months) was 62.9%. This was not affected by the CYP2B6 polymorphism (P=0.864; [Figure 1]). Event-free survival of patients with high LPL expression was only 42.1% compared with 87.5% event-free survival of patients with low LPL expression (P=0.048; [Figure 2]).
Figure 1 Kaplan–Meier event-free survival chart according to the CYP2B6 polymorphism (P=0.864).

Click here to view
Figure 2 Kaplan–Meier even-free survival chart according to lipoprotein lipase expression (P=0.048).

Click here to view



  Discussion Top


In this study, we attempted to investigate the CYP2B6 polymorphism and LPL expression as possible determinants of therapeutic response to FC chemotherapy in CLL. The CYP2B6*6 variant was associated with higher FC treatment protocol-related toxicity as evidenced by hospital admission of more than three in between cycles. This finding was in concordance with the reports of Shu et al. [34] and Hofmann et al. [35]. They showed that CYP2B6*6 (CYP2B6 516G>T, and 785A>G) encoded enzymes with low metabolic capability in the CPA 4-hydroxylation reaction in vivo and in vitro. Patients with CYP2B6 516T had a lower risk of grade 2–4 toxicities and that this SNP was an indicator of CYP2B6*6. The in-vitro findings of Shu et al. [34] confirmed that the *6 allele confers lower mRNA expression and slower CPA 4-hydroxylation, indicating that its carriers are poor CPA metabolizers.

The study of Johnson et al. [2] reported concordant findings with less frequent FC-related adverse events and fewer in-hospital days among *6 carriers. In this report, CYP2B6*6 allele represented a risk of unresponsiveness to the FC protocol. The above-mentioned important report by Johnson and his colleagues described consistent findings with a lower chance of achieving remission in patients having the *6 allele. Reports discussing the impact of CYP2B6*6 on CPA exist in the literature covering lymphoma, myeloma, breast cancer, and stem-cell transplantation [15],[36]. However, to our knowledge, apart from the study of Johnson et al. [2], no other reports studied it in CLL patients.

In this study, high LPL expression was associated with elevated serum LDH and B2MG levels. It was not associated with any other studied demographic or prognostic marker. However, its expression negatively affected the event-free survival. Literature review showed concordant reports [37],[38],[39]. LPL expression was believed to be a surrogate marker for the mutational status [40]. These results agreed with those of Matrai et al. [39] who observed that LPL is a strong predictor of outcome in CLL, able to improve prognostic accuracy in good risk cytogenetic subgroups.

Lipid metabolism was thought to be crucially required for the sake of function and survival of CLL cells. This might elucidate why LPL expression is associated with progressive clinical course and short survival [28],[38].


  Conclusion Top


CYP2B6*6 infers lower CPA efficacy with lower treatment-induced side effects and increased risk of nonresponding to FC chemotherapy in CLL. LPL expression is a predictor of outcome in CLL, indicating poor survival. These findings represent CYP2B6 genotyping and LPL expression as attractive candidate markers for regular clinical use and a step toward personalized medicine to achieve the best treatment efficacy.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. N Engl J Med 2005; 352:804–815.  Back to cited text no. 1
    
2.
Johnson GG, Lin K, Cox TF, Oates M, Sibson DR, Eccles R et al. CYP2B6*6 is an independent determinant of inferior response to fludarabine plus cyclophosphamide in chronic lymphocytic leukemia. Blood 2013; 122:4253–4258.  Back to cited text no. 2
    
3.
Zenz T, Mertens D, Küppers R, Döhner H, Stilgenbauer S. From pathogenesis to treatment of chronic lymphocytic leukaemia. Nat Rev Cancer 2010; 10:37–50.  Back to cited text no. 3
    
4.
Cramer P, Hallek M. Prognostic factors in chronic lymphocytic leukemia − what do we need to know? Nat Rev Clin Oncol 2011; 8:38–47.  Back to cited text no. 4
    
5.
Hallek M, Fischer K, Fingerle-Rowson G. International Group of Investigators; German Chronic Lymphocytic Leukaemia Study Group. Addition of rituximab to fludarabine and cyclophosphamide in patients with chronic lymphocytic leukaemia: a randomised, open-label, phase 3 trial. Lancet 2010; 376:1164–1174.  Back to cited text no. 5
    
6.
Gonzalez D, Martinez P, Wade R. Mutational status of the TP53 gene as a predictor of response and survival in patients with chronic lymphocytic leukemia: results from the LRF CLL4 trial. J Clin Oncol 2011; 29:2223–2229.  Back to cited text no. 6
    
7.
Trbusek M, Smardova J, Malcikova J. Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia. J Clin Oncol 2011; 29:2703–2708.  Back to cited text no. 7
    
8.
Catovsky D, Richards S, Matutes E. UK National Cancer Research Institute (NCRI) Haematological Oncology Clinical Studies Group; NCRI Chronic Lymphocytic Leukaemia Working Group. Assessment of fludarabine plus cyclophosphamide for patients with chronic lymphocytic leukaemia (the LRF CLL4 Trial): a randomised controlled trial. Lancet 2007; 370:230–239.  Back to cited text no. 8
    
9.
Flinn IW, Neuberg DS, Grever MR. Phase III trial of fludarabine plus cyclophosphamide compared with fludarabine for patients with previously untreated chronic lymphocytic leukemia: US Intergroup Trial E2997. J Clin Oncol 2007; 25:793–798.  Back to cited text no. 9
    
10.
Eichhorst BF, Busch R, Hopfinger G. German CLL Study Group. Fludarabine plus cyclophosphamide versus fludarabine alone in first-line therapy of younger patients with chronic lymphocytic leukemia. Blood 2006; 107:885–891.  Back to cited text no. 10
    
11.
Mo SL, Liu YH, Duan W, Wei MQ, Kanwar JR, Zhou SF. Substrate specificity, regulation, and polymorphism of human cytochrome P450 2 B6. Curr Drug Metab 2009; 10:730–753.  Back to cited text no. 11
    
12.
Roy P, Yu LJ, Crespi CL, Waxman DJ. Development of a substrate-activity based approach to identify the major human liver P-450 catalysts of cyclophosphamide and ifosfamide activation based on cDNA expressed activities and liver microsomal P-450 profiles. Drug Metab Dispos 1999; 27:655–666.  Back to cited text no. 12
    
13.
Li J, Menard V, Benish RL. Worldwide variation in human drug-metabolism enzyme genes CYP2B6 and UGT2B7: implications for HIV/AIDS treatment. Pharmacogenomics 2012; 13:555–570.  Back to cited text no. 13
    
14.
Zanger UM, Klein K, Saussele T, Blievernicht J, Hofmann MH, Schwab M. Polymorphic CYP2B6: molecular mechanisms and emerging clinical significance. Pharmacogenomics 2007; 8:743–759.  Back to cited text no. 14
    
15.
Zanger UM, Klein K. Pharmacogenetics of cytochrome P450 2B6 (CYP2B6): advances on polymorphisms, mechanisms, and clinical relevance. Front Genet 2013; 4:24.  Back to cited text no. 15
    
16.
Nakajima M, Komagata S, Fujiki Y. Genetic polymorphisms of CYP2B6 affect the pharmacokinetics/pharmacodynamics of cyclophosphamide in Japanese cancer patients. Pharmacogenet Genomics 2007; 17:431–445.  Back to cited text no. 16
    
17.
Melanson SE, Stevenson K, Kim H. Allelic variations in CYP2B6 and CYP2C19 and survival of patients receiving cyclophosphamide prior to myeloablative hematopoietic stem cell transplantation. Am J Hematol 2010; 85:967–971.  Back to cited text no. 17
    
18.
Rotger M, Tegude H, Colombo S. Predictive value of known and novel alleles of CYP2B6 for efavirenz plasma concentrations in HIV-infected individuals. Clin Pharmacol Ther 2007; 81:557–566.  Back to cited text no. 18
    
19.
Desta Z, Saussele T, Ward B. Impact of CYP2B6 polymorphism on hepatic efavirenz metabolism in vitro. Pharmacogenomics 2007; 8:547–558.  Back to cited text no. 19
    
20.
Xie HJ, Yasar U, Lundgren S. Role of polymorphic human CYP2B6 in cyclophosphamide bioactivation. Pharmacogenomics J 2003; 3:53–61.  Back to cited text no. 20
    
21.
Ariyoshi N, Ohara M, Kaneko M. Q172H replacement overcomes effects on the metabolism of cyclophosphamide and efavirenz caused by CYP2B6 variant with Arg262. Drug Metab Dispos 2011; 39:2045–2048.  Back to cited text no. 21
    
22.
Klein U, Tu Y, Stolovitzky GA, Mattioli M, Cattoretti G, Husson H et al. Gene expression profiling of B cell chronic lymphocytic leukemia reveals a homogeneous phenotype related to memory B cells. J Exp Med 2001; 194:1625–1638.  Back to cited text no. 22
    
23.
Rosenwald A, Alizadeh AA, Widhopf G, Simon R, Davis RE, Yu X et al. Relation of gene expression phenotype to immunoglobulin mutation genotype in B cell chronic lymphocytic leukemia. J Exp Med 2001; 194:1639–1647.  Back to cited text no. 23
    
24.
Oppezzo P, Vasconcelos Y, Settegrana C, Jeannel D, Vuillier F, Legarff-Tavernier M et al. French Cooperative Group on CLL. The LPL/ADAM29 expression ratio is a novel prognosis indicator in chronic lymphocytic leukemia. Blood 2005; 106:650–657.  Back to cited text no. 24
    
25.
Kristensen L, Kristensen T, Abildgaard N, Royo C, Frederiksen M, Mourits-Andersen T et al. LPL gene expression is associated with poor prognosis in CLL and closely related to NOTCH1 mutations. Eur J Haematol 2016; 97:175–182.  Back to cited text no. 25
    
26.
Mead JR, Irvine SA, Ramji DP. Lipoprotein lipase: structure, function, regulation, and role in disease. J Mol Med 2002; 80:753–769.  Back to cited text no. 26
    
27.
Kuemmerle NB, Rysman E, Lombardo PS, Flanagan AJ, Lipe BC, Wells WA et al. Lipoprotein lipase links dietary fat to solid tumor cell proliferation. Mol Cancer Ther 2011; 10:427–436.  Back to cited text no. 27
    
28.
Rozovski U, Hazan-Halevy I, Barzilai M, Keating MJ, Estrov Z. Metabolism pathways in chronic lymphocytic leukemia. Leuk Lymphoma 2015; 8:1–8.  Back to cited text no. 28
    
29.
Schmitt B, Wendtner CM, Bergmann M, Busch R, Franke A, Pasold R et al. Fludarabine combination therapy for the treatment of chronic lymphocytic leukemia. Clin Lymphoma 2002; 3:26–35.  Back to cited text no. 29
    
30.
Cheson BD, Bennett JM, Grever M, Kay N, Keating MJ, O’Brien S, Rai KR. National Cancer Institute sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood 1996; 87:4990–4997.  Back to cited text no. 30
    
31.
Damronglerd P, Sukasem C, Thipmontree W, Puangpetch A, Kiertiburanakul S. A pharmacogenomic prospective randomized controlled trial of CYP2B6 polymorphisms and efavirenz dose adjustment among HIV infected Thai patients: a pilot study. Pharmgenomics Pers Med 2015; 8:155–162.  Back to cited text no. 31
    
32.
Van’t Veer MB, Brooijmans AM, Langerak AW, Verhaaf B, Goudswaard CS, Graveland WJ et al. The predictive value of lipoprotein lipase for survival in chronic lymphocytic leukemia. Haematologica 2006; 91:56–63.  Back to cited text no. 32
    
33.
Van Bockstaele F, Pede V, Janssens A, Callewaert F, Offner F, Verhasselt B et al. Lipoprotein lipase mRNA expression in whole blood is a prognostic marker in B cell chronic lymphocytic leukemia. Clin Chem 2007; 53:204–212.  Back to cited text no. 33
    
34.
Shu W, Chen L, Hu X, Zhang M, Chen W, Ma L et al. Cytochrome P450 genetic variations can predict mRNA expression, cyclophosphamide 4-hydroxylation, and treatment outcomes in Chinese patients with non-Hodgkin’s lymphoma. J Clin Pharmacol 2017; 57:886–898.  Back to cited text no. 34
    
35.
Hofmann MH, Blievernicht JK, Klein K, Saussele T, Schaeffeler E, Schwab M, Zanger UM. Aberrant splicing caused by single nucleotide polymorphism c.516G>T [Q172H], a marker of CYP2B6*6, is responsible for decreased expression and activity of CYP2B6 in liver. J Pharmacol Exp Ther 2008; 325:284–292.  Back to cited text no. 35
    
36.
Raccor BS, Claessens AJ, Dinh JC, Park JR, Hawkins DS, Thomas SS et al. Potential contribution of cytochrome P450 2B6 to hepatic 4-hydroxycyclophosphamide formation in vitro and in vivo. Drug Metab Dispos 2012; 40:54–63.  Back to cited text no. 36
    
37.
Kaderi MA, Kanduri M, Buhl AM, Sevov M, Cahill N, Gunnarsson R et al. LPL is the strongest prognostic factor in a comparative analysis of RNA based markers in early chronic lymphocytic leukemia. Haematologica 2011; 96:1153–1160.  Back to cited text no. 37
    
38.
Porpaczy E, Tauber S, Bilban M, Kostner G, Gruber M, Eder S et al. Lipoprotein lipase in chronic lymphocytic leukaemia − strong biomarker with lack of functional significance. Leuk Res 2013; 37:631–636.  Back to cited text no. 38
    
39.
Mátrai Z, Andrikovics H, Szilvási A, Bors A, Kozma A, Ádám E et al. Lipoprotein lipase as a prognostic marker in chronic lymphocytic leukemia. Pathol Oncol Res 2017 23:165–171.  Back to cited text no. 39
    
40.
Prieto D, Oppezzo P. Lipoprotein lipase expression in chronic lymphocytic leukemia: new insights into leukemic progression. Molecules 2017; 22:E2083.  Back to cited text no. 40
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed126    
    Printed8    
    Emailed0    
    PDF Downloaded13    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]