• Users Online: 18
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 44  |  Issue : 3  |  Page : 168-174

Single nucleotide polymorphism in FCƔRIIa and FCƔRIIIa and its association with the incidence of childhood primary immune thrombocytopenia


1 Clinical and Chemical Pathology Department, Faculty of Medicine, Beni-Suef University, Beni-Suef, Egypt
2 Department of Pediatrics, Faculty of Medicine, Beni-Suef University, Beni-Suef, Egypt
3 Department of Community Medicine, Faculty of Medicine, Beni-Suef University, Beni-Suef, Egypt

Date of Submission05-Mar-2018
Date of Acceptance05-Mar-2018
Date of Web Publication05-Dec-2019

Correspondence Address:
Noha A Doudar
Faculty of Medicine, Beni-Suef University
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ejh.ejh_7_18

Rights and Permissions
  Abstract 


Introduction Immune thrombocytopenia purpura (ITP) is characterized by severe autoimmune destruction of platelets. Genetic factors play an important role in its pathogenesis. The objective of this study is to investigate the association of FCƔRIIa and FCƔRIIIa gene polymorphism with childhood ITP regarding the severity and response.
Patients and methods A total of 55 pediatric patients with ITP and 55 age-matched and sex-matched healthy controls were enrolled in the study to detect the association between the polymorphisms and ITP. Genotyping of FCƔRIIa was performed using PCR-restriction fragment length polymorphism, and genotyping of FCƔRIIIa was performed via TaqMan 5’-allelic discrimination technique.
Results Distribution of FCƔRIIa single nucleotide polymorphism (SNP) alleles revealed that the allele frequency distribution for children with ITP was 56.4 and 43.6% for H and R alleles, respectively, with no statistically significant differences when compared with control (P=0.891). The frequency distribution of FCƔRIIa genotypes of patients with ITP showed no statistically significant differences when compared with control (χ2=10.3, P=0.005). Regarding FCƔRIIIa SNP genotypes, the heterozygous mutant VF genotype was statistically higher in patient group compared with healthy control.
Conclusion There is a role of heterozygous VF genotype and FCƔRIIIa V/F SNP in the pathogenesis of childhood ITP. No association between the development of ITP and FCƔRIIa gene polymorphism was found. Both FCƔRIIa R/H and FCƔRIIIa V/F are not related to severity of ITP or response to treatment.

Keywords: children, FCƔRIIa and FCƔRIIIa, immune thrombocytopenia purpura, PCR


How to cite this article:
Mohamed RA, Morgan DS, Anwar MM, Doudar NA. Single nucleotide polymorphism in FCƔRIIa and FCƔRIIIa and its association with the incidence of childhood primary immune thrombocytopenia. Egypt J Haematol 2019;44:168-74

How to cite this URL:
Mohamed RA, Morgan DS, Anwar MM, Doudar NA. Single nucleotide polymorphism in FCƔRIIa and FCƔRIIIa and its association with the incidence of childhood primary immune thrombocytopenia. Egypt J Haematol [serial online] 2019 [cited 2020 Jan 19];44:168-74. Available from: http://www.ehj.eg.net/text.asp?2019/44/3/168/272372




  Introduction Top


Childhood immune thrombocytopenia purpura (ITP) is one of the most common benign disorders of bleedings, which is distinguished by the presence of isolated thrombocytopenia without the coexistence of any other latent cause [1].

The production of antiplatelet antibodies is the principal factor in the occurrence of ITP. Platelets opsonized by antiplatelet antibodies are destined for splenic clearance, which results in decreased level of platelets [2]. Furthermore, the presence of these antibodies may result in the diminished production of platelets, and hence generate a dual source, resulting in the causation of thrombocytopenia [3].

ITP is an acute, self-limited disease that spontaneously improves or resolves within months. However, in a small percent of children and in numerous adults, ITP may become chronic and resistant to management [4].

ITP is a multifactorial disease that results from the interplay between genetic and nongenetic factors. Numerous environmental risk factors have been detected for ITP, and these included autoimmune diseases, drug interactions, and viral infections [5]. Furthermore, genetic risk factors have been also implicated in the susceptibility to ITP, as numerous genetic single nucleotide polymorphism (SNP) might be associated with the occurrence and progression of ITP [6].

Human FC receptors (FCRs) are glycoproteins that bind the Fc portion of immunoglobulin G (IgG), and they belong to the Ig superfamily. Human FCRs are classified into three classes: FCRI (CD64), FCRII (CD32), and FCR III (CD16); each of these has its own functional and structural and functional properties [7]. Structural differences of these antibodies have resulted in differences in their antibody affinities. Low-affinity activating receptors, such as FCRII and FCRIII, only bind immune-complexed IgG [8]. Gene polymorphisms of FCRs (CD32 and CD16), may alter the receptor affinity to bind to Igs [9].

In humans, there are several polymorphisms that exist for both FCRII and FCRIII. The biological importance of the polymorphisms in these receptors is due to their altered affinities to IgG, which results in differences in immune complexes clearance rates, in patients who express such variants [10]. Two SNPs in these genes have been related to ITP: the first one is a single amino acid substitution in FCƔRIIa, where histidine (H) replaces arginine (R) at position 131. The second SNP involves a single amino acid substitution in FCIIIa, where valine (V) replaces phenyl alanine (F) at position 158 [9].

There are conflicting data regarding the significance of the aforementioned polymorphism and the incidence of childhood ITP [7]. Therefore, taking into our considerations such conflicting results, we set to investigate the association of FCƔRIIa and FCƔRIIIa with childhood ITP in a group of pediatric Egyptian patients. In addition, we investigated the association of these SNPs and severity of ITP and response rate to treatment in our study group.


  Patients and methods Top


Patients

The current case–control study was conducted on 55 pediatric patients with immune thrombocytopenia (acute and chronic) and 55 age-matched and sex-matched healthy controls. The patients with ITP (27 females and 28 males) were recruited from the outpatient clinic of the Pediatric Department of Beni-Suef University Hospital, in Egypt, between June 2016 and September 2016. The patients were diagnosed by a pediatrician according to the guidelines of the American Society of Heamatology [11]. The patients’ guardians and controls guardians included in the study were informed of the purpose of the study, and their consent was obtained. Ethical approval was obtained from of Beni-Suef University and was conducted in accordance with the 1964 Helsinki declaration and its later amendments in 2004.

Clinical and laboratory assessment

Physical examination for all the participants was done. Criteria for exclusion included the following: infants below 6 months of age, ITP owing to secondary causes such as systemic lupus erythematosis or recent manifestations of active infection. In addition, patients with concomitant autoimmune disorders, such as juvenile rheumatoid arthritis, vitiligo, and type 1 diabetes mellitus, were excluded from the study. Laboratory assessment included complete blood picture revealing isolated thrombocytopenia (platelet count <100×109/l).

The severity of the diseases at the time of sampling was assessed according to the presence of significant bleeding using specific bleeding score [12].

Newly diagnosed ITP (acute) is defined as thrombocytopenia up to 3 months since diagnosis, persistent ITP is defined as thrombocytopenia lasting from 3 to 12 months since diagnosis, whereas chronic ITP is persistent thrombocytopenia for more than 12-month duration [13].

Defining the disease state at the time of sampling was done according to Zhou et al. [14]. Overall, 52.7% of patients were in activity (platelet count is <100×109/l and 47.3% were in remission (platelet count is >100×109/l).

Assessment of laboratory response to treatment done according to Rodeghiero et al. [13] was applied in the patients group as follow: (a) nonresponders who had platelet count less than 30×109/l or less than doubling of the baseline count, (b) partial responders who had platelet count 30–100×109/l or at least doubling of the baseline count, and (c) complete responders who had platelet count more than 100×109/l.

Genotyping of FCƔRIIa-131R/H and FCƔRIIIa-158V/F

Approximately 4–6 ml of venous blood was collected under aseptic conditions in a sterile EDTA vaccutainer. Genomic DNA estimation was performed from EDTA anti-coagulated whole blood using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The gDNA extraction procedure was followed by measuring the gDNA concentration, which was measured by NanoDrop spectrophotometry (Nanodrop, Berlin, Germany).

Genotyping of FCƔRIIa-131R/H was performed via PCR using the primers described by Eyada et al. [2]. The total reaction volume was 25 μl : 5 μl (40–50 ng) DNA, 12.5 μl. Dream Taq green PCR master mix (Fermentas), 1 μl of each primer and 5.5 μl nuclease-free water. The PCR was performed in (Biometra) T-personal thermal cycler (Analytik Jena, Germany), under the cycling conditions described by Eyada et al. [2].

The PCR was followed by digestion with the restriction enzyme BstUI (Cat. No.: #ER0921; Thermo Scientific™, USA) according to the manufacturer’s protocol ([Figure 1]). Following enzyme digestion, the PCR fragments were separated by 4% agarose gel electrophoresis stained with ethidium bromide followed by ultraviolet visualization. The enzymatic digestion of the PCR products generated a 337-bp uncleaved fragment which represented the H allele, a 316-bp fragment, and a 21-bp fragment, which represented the R allele.
Figure 1 Genotyping of FCƔRIIa-131R/H using PCR-RFLP technique. M, 50–1000 bp marker ladder, Lanes: 1, 3, 4, 8, and 9 represent RR genotype, lanes: 6 and 7 represent HH genotype, and lanes: 2 and 5 represent RH genotypes. RFLP, restriction fragment length polymorphism.

Click here to view


Genotyping of FCRIIIa-158V/F was performed via TaqMan 5’-allelic discrimination technique. The sense sequence was 5′-ATC AGA TTC GAT CCT ACT TCT GCA GGG GGC AT-3’, whereas the antisense sequence was 5’-ACG TGC TGA GCT TGA GTG ATG GTG ATG TTC AC-3’. The TaqMan MGB probes/extension primers were VIC AACTCGTTCTTGAAAGGAGAAAGCC to detect allele 1 sequence and 6FAMACCGCCCCCTTTCTCCTGCACAACT to detect allele 2 sequence. The total PCR reaction volume was 20 μl : 40 ng/μl gDNA, 10 μl 2× Universal TaqMan master mix II (Applied Biosystems, Waltham, Massachusetts, USA), 0.5 μl 20× SNP assay mix and adjusted to a final volume of 20 μl using nuclease-free water. The PCR was performed in StepOne System (Applied Biosystems) under the following conditions: initial enzyme activation at 95°C for 10 min, followed by 40 cycles of amplification; denaturation at 95°C for 15 s, and annealing/extension for 1 min at 60°C. Florescence data collection at annealing/extension step was done for 6FAM and VIC dye.

Statistical analysis

Data were analyzed using statistical package for the social science (Released 2009, PASW Statistics for Windows, version 16; SPSS Inc., Chicago, Illinois, USA). Descriptive statistics as frequency distribution, percentage, and mean±SD were calculated. Student’s t test was done if indicated. χ2 test was used for qualitative data comparison, and Fisher’s exact test was used when the cell count was less than 5. Odds ratios with 95% confidence intervals were calculated to test the association between genotype and ITP. Whitney U test was used to calculate nonparametric data. Genotype distributions were compared with those expected for samples from populations in Hardy–Weinberg equilibrium (HWE) using a χ2 test (1 df). P value was considered significant if less than or equal to 0.05.


  Results Top


In the current case–control study, the study population comprised 55 children diagnosed as having ITP and 55 healthy controls. The female patients comprised 49.1% (N=27), whereas the percentage of male patients comprised 50.9% (N=28) in the case group. On the contrary, in the control group, the percentage of females was 45.46% (N=25), whereas the percentage of males was 54.54% (N=30). The mean age of the patients was 6.29±3.76 years, whereas the mean age of the healthy controls was 5.38±2.1 years. The demographic, clinical, and laboratory data of the patients and the healthy control group are summerized in [Table 1].
Table 1 The clinical, laboratory, and clinical data of patients with immune thrombocytopenic purpura and healthy control group

Click here to view


The fequency distribution of FCƔRIIa and FCƔRIIIa SNP genotypes in children with ITP did not show deviation from HWE (P=0.051 and 0.28, respectively). Similarly, the genotype fequency distribution of healthy controls conformed with HWE (P=0.48 and 0.058, respectively).

Analysis of distribution of FCƔRIIa SNP alleles revealed that the allele frequency distribution for children with ITP was 56.4 and 43.6% for H and R alleles, respectively. On the contrary, the frequency distribution for H and R alleles in healthy controls is 55.5 and 44.5%, respectively, with no statistically significant difference between the two groups (P=0.891) ([Table 2]).
Table 2 Genotype and allele frequencies of FCƔRIIa and FCRIIIa gene polymorphism in primary immune thrombocytopenia purpura cases and healthy controls

Click here to view


In the current study, on comparing the fequency distribution of FCƔRIIa genotypes between children with ITP and control groups, there was no statistically significant difference between both the groups (χ2=1.80, P=0.406) ([Table 2]).

Similarily, analysis of the frequency distribution of FCƔRIIIa SNP alleles, between both patients with ITP and the control revealed no statistically significant difference between the two groups (P=0.172) ([Table 2]).

Analysis of the frequency distribution of FCƔRIIIa SNP genotypes between ITP patients and the healthy control group revealed that the heterozygous mutant VF genotype was statistically higher in the patient group compared with the healthy control group (χ2=10.30, P=0.005) ([Table 2]).

In the current case–control study, we compared the association between both FCƔRIIa and FCƔRIIIa SNPs in the patient group regarding age, sex, clinical characteristics, and laboratory data; however, no statistically significant difference was detected (data not shown).

In addition, no statistically significant association was detected regarding comparing the grades of bleeding severity and the genetic association of both FCƔRIIa and FCƔRIIIa SNPs in the patient group (P=0.451 and 0.811, respectively) ([Table 3]).
Table 3 Grades of bleeding severity in FCƔRIIa and FCRIIIa single nucleotide polymorphisms in primary immune thrombocytopenia purpura cases

Click here to view


For our final analysis, we investigated the association between FCƔRIIa and FCƔRIIIa SNPs in the patient group and the quality of laboratory response regarding the increase in platelet count in response to different therapeutic modalities after 3 months from the initial sampling. Our results did not indicate the presence of an association between the SNPs and the therapeutic response to different therapeutic modalities (P=0.617 and 0.424, respectively) ([Table 4]).
Table 4 Quality of laboratory response at follow-up in FCƔRIIa and FCƔRIIIa single nucleotide polymorphisms in primary immune thrombocytopenia purpura cases

Click here to view



  Discussion Top


The development of ITP might be explicable by the occurrence of a key genetic change that is related to a dysfunction in the immune system [15]. A wide range of pathologies could explain thrombocytopenia; however, the mechanism underlying the occurrence of thrombocytopenia remains obscure, although the destruction of platelets by phagocytic cells is a fundamental mechanism in the occurrence of ITP [4]. Human Fcγ receptors are glycoprotein that through binding to the Fc portion of IgG are involved in the preservation of antibodies. Several studies have indicated that gene polymorphisms of FCƔRIIa and FCƔRIIIa (CD32 and CD16) might result in alteration of the receptor-binding affinity to Igs [16].

Antiplatelet antibodies of IgG classes play a fundamental role in the development of ITP. IgG deposition is followed by Fcγ receptor-mediated ingestion by phagocytes. FCƔRIIa (CD32) displays a G to A point mutation in the region specifying its ligand binding domain resulting in an arginine (R) to histidine (H) substitution at position 131 [17]. Similarly, the FCƔRIIIa (CD16) displays a point mutation, resulting in T to G substitution at the nucleotide 559, leading to a valine (V) to phenyl alanine (F) substitution at position 158 [17].

In the current case–control study, on investigating the role of FCƔRIIa R/H gene polymorphism in the development of childhood ITP, our findings suggested that it is not associated with the susceptibility to ITP. Our results conformed with the results of the study conducted by Papagianni et al. [7], which documented that there was no statistically significant differences detected between children with ITP and the controls included in the study. Similarly, our results regarding the association of FCƔRIIa H/R gene polymorphism in the development of childhood ITP conformed with the results of the studies conducted by Horsewood et al. [18] and Fujimoto et al. [19]. In contrast, our results were inconsistent with the results of the studies conducted by Eyada et al. [16] and Foster et al. [20].

Our results regarding the lack of association between FCƔRIIa R/H gene polymorphism in the development of childhood ITP could be explained by the fact that although FCƔRIIa-H 131 represents the sole receptor capable of efficient interaction with human IgG2, the capacity to bind effectively to human IgG is dependent on the individual’s FCƔRIIa genotype and is related to ethnic differences [17].

In the current case–control study, our results concerning the association of FCƔRIIIa V/F gene polymorphism in the development of childhood ITP indicated that the heterozygous (VF) genotype might be associated with the development of ITP as frequency distribution of patients who have inherited the VF genotype was higher compared with healthy controls (P=0.005). However, we did not detect a statistically significant difference in allele frequencies of FCƔRIIIa V/F gene polymorphism in patients and healthy control (P=0.172).

Our results regarding the association of FCƔRIIIa V/F SNP and ITP conformed to the results of Papagianni et al. [7] which implicated that the heterozygous (VF) genotype was significantly statistically higher in children with ITP compared with the control group. Similarly, the meta-analysis conducted by Xu et al. [9] suggested that FCƔRIIIa V/F SNP plays a critical key role in the development of childhood ITP. In addition, similar results were delineated by several other studies such as by Eyada et al. [16] and Carcao et al. [21]. The results of the current study conformed with the results obtained by Pavkovic et al. [22] in adult patients with ITP.

On the contrary, our results were inconsistent with the results reported by Kuhne [23] which did not detect a statistically significant association in the frequency distribution of FCƔRIIIa V/F SNP between patients with ITP and the healthy controls.

The results of the current study regarding the role of FCƔRIIIa V/F SNP in the pathogenesis of childhood ITP could explained by the fact that the presence of valine instead of phenyl alanine in codon 158 may alter the binding affinity for IgG1 and IgG3 resulting in a higher binding capacity for the γ-Ig and hence might result in a higher destruction rate of IgG-autoantibody-coated platelets, which contributes to a greater tendency for the development of ITP [16],[9].

The discrepancy in the results of different studies regarding the role of FCƔRIIa R/H SNP and FCƔRIIIa V/F SNP could be attributed to ethnic differences between patients with ITP, differences in the number of patients included in the studies, differences in inclusion criteria and differences in genotyping techniques used.

Our results regarding comparing the association between both FCƔRIIa and FCƔRIIIa SNPs in the patient group regarding age, sex, clinical characteristics, and laboratory data conformed with other sudies conducted by Eyada et al. [16] and Carcao et al. [21].

In addition, our results indicated the lack of association between FCƔRIIa and FCƔRIIIa SNPs and the severity of ITP as indicated by the grades of bleeding severity. Regarding FCƔRIIa SNP, our results conformed with the results of Horsewood et al. [18]. However, there were no reports found regarding the role of FCRIIIa SNP and severity of ITP.

The results of the current study regarding the association between FCƔRIIa and FCƔRIIIa SNPs and response rate to different treatment modalities, which suggested the lack of statistical association between response rate and different treatment modalities, were in conformation with the studies performed by Fujimoto et al. [19] and Papagianni et al. [7].


  Conclusion Top


The Current study supports the role of the heterozygous FCƔRIIIa VFgenotype in the pathogenesis of childhood ITP. Our results did not detect an association between the development of ITP and FCƔRIIa R/H. Both FCƔRIIa R/H and and FCƔRIIIa V/F SNP are not related to severity of ITP and resopnse rate to different treatment modalities. However, the results of the current study should be considered with caution, and futher studies with larger population samples are needed to establish the genetic association.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Zoheir N, Ragab L, AbouEnein A, El-Dessoki N, Soliman D, AbdelWahab I, El-Sobky M. Frequency of Fcy receptor IIIa-158V polymorphisms in Egyptian children with immune thrombocytopenic purpura. Med J Cairo Univ 2009; 77:591–595.  Back to cited text no. 1
    
2.
Eyada TK, Farawela HM, Khorshied MM, Shaheen IA, Selim NM, Khalifa IA. FcgammaRIIa and FcgammaRIIIa genetic polymorphisms in a group of pediatric immune thrombocytopenic purpura in Egypt. Blood Coagul Fibrinolysis 2012; 23:64–68.  Back to cited text no. 2
    
3.
Psaila B, Bussel JB. Immune thrombocytopenic purpura. Hematol Oncol Clin N Am 2007; 21:743–759.  Back to cited text no. 3
    
4.
Morgan D, Afifi R, El-Hoseiny SM, Amin D, Ibrahim S. The potential association of tumor necrosis factor-βeta (252 G/A) cytokine gene polymorphism with immune thrombocytopenic purpura among Egyptian children. Hematology 2018; 23:299–303.  Back to cited text no. 4
    
5.
Johnsen J. Pathogenesis in immune thrombocytopenia: new insights. Hematology Am Soc Hematol Educ Program 2012; 2012:306–312.  Back to cited text no. 5
    
6.
Amorim DM, SilveiraVda S, Scrideli CA, Queiroz RG, Tone LG. Fcgamma receptor gene polymorphisms in childhood immune thrombocytopenic purpura. J Pediatr Hematol Oncol 2012; 34:349–352.  Back to cited text no. 6
    
7.
Papagianni A, Economou M, Tragiannidis A, Karatza E, Samarah F, Gombakis N et al. FCƔRIIa and FCƔRIIIa polymorphisms in childhood primary immune thrombocytopenia: implications for disease pathogenesis and outcome. Blood Coagul Fibrinolysis 2013; 24:35–39.  Back to cited text no. 7
    
8.
Hoemberg M, Stahl D, Schlenke P, Sibrowski W, Pachmann U, Cassens U. The isotype of autoantibodies influences the phagocytosis of antibody-coated platelets in autoimmune thrombocytopenic purpura. Scand J Immunol 2011; 74:489–495.  Back to cited text no. 8
    
9.
Xu J, Zhao L, Zhang Y, Guo Q, Chen H. CD16 and CD32 gene polymorphisms may contribute to risk of idiopathic thrombocytopenic purpura. Med Sci Monit 2016; 22:2086–2096.  Back to cited text no. 9
    
10.
van der Pol WL, Jansen MD, Sluiter WJ, van de Sluis B, Leppers-van de Straat FG, Kobayashi T et al. Evidence for nonrandom distribution of Fcgamma receptor genotype combinations. Immunogenetics 2003; 55:240–246.  Back to cited text no. 10
    
11.
Neunert C, Lim W, Crowther M, Cohen A, Solberg L Jr, Crowther MA. The American Society of Hematology 2011 evidence-based practice guideline for immune thrombocytopenia. Blood 2011; 117:4190–4207.  Back to cited text no. 11
    
12.
Provan D, Stasi R, Newland AC et al. International consensus report on the investigation and management of primary immune thrombocytopenia. Blood 2010; 115:168–186.  Back to cited text no. 12
    
13.
Rodeghiero F, Stasi R, Gernsheimer T et al. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international. Working group. Blood 2009; 113:2386–2393.  Back to cited text no. 13
    
14.
Zhou Z, Chen Z, Li H et al. BAFF and BAFF-R of peripheral blood and spleen mononuclear cells in idiopathic thrombocytopenic purpura. Autoimmunity 2009; 42:112–119.  Back to cited text no. 14
    
15.
Podolanczuk A, Lazarus AH, Crow AR, Grossbard E, Bussel JB. Of mice and men: an open-label pilot study for treatment of immune thrombocytopenic purpura by an inhibitor of Syk. Blood 2009; 113:3154–3160.  Back to cited text no. 15
    
16.
Eyada TK, Farawela HM, Khorshied MM, Shaheen IA, Selim NM, Khalifa IAS. FCƔRIIa and FCƔRIIIa genetic polymorphisms in a group of pediatric immune thrombocytopenic purpura in Egypt. Blood Coagul Fibrinolysis 2012; 23:64–68.  Back to cited text no. 16
    
17.
van Sorge NM, van der Pol WL, van de Winkel JG. FcgammaR polymorphisms: implications for function, disease susceptibility and immunotherapy. Tissue Antigens 2003; 61:189–202.  Back to cited text no. 17
    
18.
Horsewood P, Zyba S, Kelton JG. Role of the platelet FcRIIA polymorphism in idiopathic thrombocytopenic purpura (ITP). Blood 1998; 92:85b.  Back to cited text no. 18
    
19.
Fujimoto T-T., Inoue M, Shimomura T, Fujimura K. Involvement of Fcγ receptor polymorphism in the therapeutic response of idiopathic thrombocytopenic purpura. Br J Hematol 2001; 115:125–130.  Back to cited text no. 19
    
20.
Foster CB, Zhu S, Erichsen HC, Lehrnbecher T, Hart ES, Choi E et al. Polymophisms in inflammatory cytokines and Fc(receptors in childhood chronic immune thrombocytopenic purpura: a pilot study. Br J Haematol 2001; 113:596–599.  Back to cited text no. 20
    
21.
Carcao MD, Blanchette VS, Wakefield CD, Stephens D, Ellis J, Matheson K et al. Fc (receptor IIa and IIIa polymorphisms in childhood immune thrombocytopenic purpura. Br J Haematol 2003; 120:135–141.  Back to cited text no. 21
    
22.
Pavkovic M, Petlichkovski A, Karanfilski O, Cevreska L, Stojanovic A. FC gamma receptor polymorphisms in patients with immune thrombocytopenia. Hematology 2017; 23:1–6. 10.1080/10245332.2017.1377902  Back to cited text no. 22
    
23.
Kuhne T. Idiopathic thrombocytopenic purpura in childhood, controversies and solutions. Paediatr Blood Cancer 2006; 47: 650–652.  Back to cited text no. 23
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed170    
    Printed16    
    Emailed0    
    PDF Downloaded30    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]